Docs For Class Str

Class Str

Description

String.php

String class, for biological sequences

$oSeq = new Seq("GAGATGGATGTAGATTATTAGTATATG", "DnaAlphabet", TRUE);
print $oSeq->getData();
$oSeq->rev();
print $oSeq->getData();

author: Mark Brooks
version: 0.8.2
copyright: 2004-2008 Mark Brooks <markabrooks@users.sourceforge.net>
access: public

Located in /Root/Str.php (line 51)

PEAR
   |
   --Bio
      |
      --Str

Direct descendents

Class	Description
Seq	Seq

Method Summary

static string InTrim_ (string $sStr)

static string Left_ (string $sStr, $iNumChars, int $numChars)

static void Len_ ([string $sStr = ""])

static array ReMatch_ (string $sNeedle, $sHayStack, [boolean $bCaseSensitive = TRUE], string $sHaystack)

static array ReReplace_ (string $sNeedle, $sNewNeedle, boolean $sHayStack, [ $bCaseSensitive = TRUE], string $sHaystack)

static array ReSplit_ (string $sNeedle, string $sHaystack, [boolean $bCaseSensitive = TRUE])

static string Rev_ ([ $sStr = ""], string $Str)

static string Right_ (string $sStr, int $iNumChars)

static void Sub_ ( $sStr, $iStart, [ $iLength = ""])

static array SymFreq_ (string $sSymbol, string $sStr, [boolean $bCaseSensitive = TRUE])

static string Trim_ ( &$sStr, string $sStr)

object __construct ([string $sStr = ""], [boolean $bIsRev = 0])

void cat (Str $oOther, object Seq $other)

string catStr ( $sOther, string $otherStr)

string CatStr_ ( $sFirst, $sOther, string $otherStr)

void errorCallBack ( $oError)

string getData ()

bool getIsRev (none 0)

string getRev (none 0)

string inTrim ()

string left (int $iNnumChars, string $sStr)

integer len ()

array reMatch (string $sNeedle, [boolean $bCaseSensitive = TRUE])

string rev (none 0)

string right ( $iNumChars, string $sStr, int $iChars)

void setData ( $sData, string $sStr)

void setIsRev (boolean $bIsRev)

void sub ( $iStart, [ $iLength = ""])

array symFreq (string $sSymbol, [boolean $bCaseSensitive = TRUE])

boolean toggleIsRev (none 0)

string trim ()

string __toString ()

Variables

Inherited Variables

Inherited from Bio

Bio::$bWarnings

Methods

static method InTrim_ (line 469)

function InTrim_

Strips internal whitespace from a sequence

static string InTrim_ (string $sStr)

string $sStr

Redefined in descendants as:

NucAcid::InTrim_() : InTrim_

static method Left_ (line 577)

function Left_ desc Return the first $numChars characters of a string.

return: substring

static string Left_ (string $sStr, $iNumChars, int $numChars)

string $sStr
int $numChars: number of chars to return
$iNumChars

static method Len_ (line 431)

function Len_

Nothing to do with Coronation Street

access: public

static void Len_ ([string $sStr = ""])

string $sStr

static method ReMatch_ (line 351)

function ReMatch_

Simple function to search strings. Where is the =~ operator when you need it?

return: Matches (or FALSE for no matches)
access: public

static array ReMatch_ (string $sNeedle, $sHayStack, [boolean $bCaseSensitive = TRUE], string $sHaystack)

string $sNeedle: String to search for
string $sHaystack: String to search in
boolean $bCaseSensitive: bCaseSensitive Is the search supposed to be case-sensitive?
$sHayStack

static method ReReplace_ (line 380)

ReReplace_

Simple function to search strings. Where is the =~ operator when you need it?

return: Matches (or FALSE for no matches)
access: public

static array ReReplace_ (string $sNeedle, $sNewNeedle, boolean $sHayStack, [ $bCaseSensitive = TRUE], string $sHaystack)

string $sNeedle: String to search for
string $sHaystack: String to search in
boolean $sHayStack: bCaseSensitive Is the search supposed to be case-sensitive?
$sNewNeedle
$bCaseSensitive

static method ReSplit_ (line 403)

function ReSplit_

return: Matches (or FALSE for no matches)
access: public
uses: Simple - function to search strings. Where is the =~ operator when you need it?

static array ReSplit_ (string $sNeedle, string $sHaystack, [boolean $bCaseSensitive = TRUE])

string $sNeedle: String to search for
string $sHaystack: String to search in
boolean $bCaseSensitive: bCaseSensitive

static method Rev_ (line 187)

function Rev_

Reverses sequence of the object, places it in $_revStr (can be used with no Seq instance)

access: public

static string Rev_ ([ $sStr = ""], string $Str)

string $Str
$sStr

static method Right_ (line 596)

function Right

return: substring
access: public
uses: Return - the substring beginning at $numChars characters from the right end of a string.

static string Right_ (string $sStr, int $iNumChars)

string $sStr
int $iNumChars: number of chars to return

static method Sub_ (line 635)

function Sub_

Hmolog of the string function substr

access: public

static void Sub_ ( $sStr, $iStart, [ $iLength = ""])

$sStr
$iStart
$iLength

static method SymFreq_ (line 299)

function SymFreq_

access: public
uses: returns - frequency of a given string in another

static array SymFreq_ (string $sSymbol, string $sStr, [boolean $bCaseSensitive = TRUE])

string $sSymbol: Symbol to be searched for
string $sStr: String to be searched in
boolean $bCaseSensitive: bCaseSensitive Is the search supposed to be case-sensitive?

static method Trim_ (line 536)

function Trim_

return: Trimmed string
uses: Removes - leading and trailing spaces from a string.

static string Trim_ ( &$sStr, string $sStr)

string $sStr: String to be trimmed
&$sStr

Constructor __construct (line 80)

function __construct

return: String Instance

object __construct ([string $sStr = ""], [boolean $bIsRev = 0])

string $sStr: String data of the object
boolean $bIsRev: Is the string reversed?

Redefinition of:

Bio::__construct(): function Bio ()

Redefined in descendants as:

Seq::__construct() : function __construct
Protein::__construct() : function __construct
NucAcid::__construct() : __construct
Dna::__construct() : function __construct
Rna::__construct() : function __construct

cat (line 712)

function cat

concats Str objects $oOther with $this

access: public

void cat (Str $oOther, object Seq $other)

object Seq $other
Str $oOther

Redefined in descendants as:

Seq::cat() : function cat

catStr (line 673)

function catStr

Workalike for MutableSeq::append in BioPython

access: public

string catStr ( $sOther, string $otherStr)

string $otherStr
$sOther

Redefined in descendants as:

Seq::catStr() : function catStr

CatStr_ (line 694)

function CatStr_

Workalike for MutableSeq::append in BioPython

access: public

string CatStr_ ( $sFirst, $sOther, string $otherStr)

string $otherStr
$sFirst
$sOther

errorCallBack (line 756)

function errorCallBack

handles errors

access: public

void errorCallBack ( $oError)

$oError

getData (line 166)

function getData

access: public

string getData ()

getIsRev (line 134)

function getIsRev

access: public

bool getIsRev (none 0)

none 0

getRev (line 232)

function getRev

Reverses sequence of this Seq object by calling revStr Requires an instance of $this and does not modify the sequence in place

return: Rev_ersed string
access: public

string getRev (none 0)

none 0

inTrim (line 497)

function inTrim

Strip whitespace from the Seq->_seqStr

string inTrim ()

left (line 556)

function left

Set the Sequence data to the the first $iNnumChars characters of a string

return: substring

string left (int $iNnumChars, string $sStr)

string $sStr
int $iNnumChars: number of chars to return

len (line 451)

function len

Calculates length of Seq obj Str data

return: length of sequence object
access: public

integer len ()

reMatch (line 330)

function reMatch Simple function to search instantiated String objects.

Calls the static func. ReMatch_ to do the work.

array reMatch (string $sNeedle, [boolean $bCaseSensitive = TRUE])

string $sNeedle: Symbol to be searched
boolean $bCaseSensitive: bCaseSensitive Is the search supposed to be case-sensitive?

rev (line 210)

function rev

Reverses sequence of this Seq object by calling revStr Requires an instance of $this and reverses the sequence in place

return: Rev_ersed string
access: public

string rev (none 0)

none 0

right (line 615)

function right

return: substring
access: public
uses: Set - the Sequence data to the substring beginning at $numChars characters from the right end of a string.

string right ( $iNumChars, string $sStr, int $iChars)

string $sStr
int $iChars: number of chars to return
$iNumChars

setData (line 150)

function setData

access: public

void setData ( $sData, string $sStr)

string $sStr: String represented
$sData

setIsRev (line 116)

function setIsRev

access: public

void setIsRev (boolean $bIsRev)

boolean $bIsRev

sub (line 653)

function sub

Calls Sub for $this Seq object

access: public

void sub ( $iStart, [ $iLength = ""])

$iStart
$iLength

symFreq (line 278)

function symFreq Simple function to search instantiated String objects for characters.

Calls the static func. SymFreq_ to do the work.

array symFreq (string $sSymbol, [boolean $bCaseSensitive = TRUE])

string $sSymbol: Symbol to be searched
boolean $bCaseSensitive: Is the search supposed to be case-sensitive?

toggleIsRev (line 254)

function toggleIsRev

access: public

boolean toggleIsRev (none 0)

none 0

trim (line 516)

function trim Removes leading and trailing spaces from a string.

return: Trimmed sequence string

string trim ()

__toString (line 98)

function __toString

string __toString ()

Redefined in descendants as:

Seq::__toString() : function __toString

Inherited Methods

Inherited From Bio

Bio::__construct()
Bio::printWithNl()

Class Constants

Inherited Constants

Inherited from Bio

Bio::NEWLINE

Documentation generated on Sun, 28 Sep 2008 11:09:40 +0200 by phpDocumentor 1.4.2