Docs For Class Transcriber

Description

Transcriber Takes a Dna Seq object and transcribes it.

$oTranscriber = new Transcriber();
$oRna = $oTranscriber->transcribe($oDnaSeq);

author: Mark Brooks <markabrooks@users.sourceforge.net>
version: 0.8.2
copyright: 2004-2008 Mark Brooks <markabrooks@users.sourceforge.net>
uses: PHP - class for transcribing RNA from DNA sequences (and vice-versa).

PEAR
   |
   --Bio
      |
      --Transcriber

Method Summary

static string RevTranscribe_ ([ $sRna = ""], string $sSeq)

static $rnaStr; Transcribe_ ([ $sDna = ""], string $sSeq)

object __construct ([object $sTranscriberType = "UnambiguousTranscriber"])

object Dna revTranscribe ( $oRna, string $sSeq)

object transcribe ( $oDna, string $sSeq)

Variables

Inherited Variables

Inherited from Bio

Bio::$bWarnings

Methods

static method RevTranscribe_ (line 115)

function RevTranscribe_

Static function to convert RNA sequence string to DNA (Reverse-transcribe it!) Does the actual work, so make improvements here!

$sDna = $oTranscriber::RevTranscribe_("GAUCUGAUGAUGAUGAUGAUGAU");

access: public

static string RevTranscribe_ ([ $sRna = ""], string $sSeq)

string $sSeq: Sequence of the nucleic acid as a string
$sRna

static method Transcribe_ (line 72)

function Transcribe Static function to convert DNA sequence str to RNA.

Does the actual work, so make improvements here!

$sRNA = $oTranscriber::Transcribe_("GATCTGATGATGATGATGATGAT");

access: public

static $rnaStr; Transcribe_ ([ $sDna = ""], string $sSeq)

string $sSeq: Sequence of the nucleic acid as a string
$sDna

Constructor __construct (line 50)

__construct

Constructor Must be an UnambiguousTranscriber, i.e. doesn't handle ambiguous bases

$oTranscriber = new Transcriber();

return: Transcriber
access: public

object __construct ([object $sTranscriberType = "UnambiguousTranscriber"])

object $sTranscriberType: Type of transcriber

Redefinition of:

Bio::__construct(): function Bio ()

revTranscribe (line 137)

function revTranscribe Convert RNA sequence string to DNA (Reverse-transcribe it!) Class function to convert Dna Seq object to an Rna Seq object and return it.

$oRna = new Rna("GAUCUGAUGAUGAUGAUGAUGAU");
$oDna = $oTranscriber->revTranscribe($oRna);

return: ;
access: public

object Dna revTranscribe ( $oRna, string $sSeq)

string $sSeq: Sequence of the RNA as an object
$oRna

transcribe (line 93)

function transcribe Class function to convert Dna Seq object to an Rna Seq object and return it.

$oDna = new Dna("GAUCUGAUGAUGAUGAUGAUGAU");
$oRna = $oTranscriber->transcribe($oDna);

return: Rna instance;
access: public

object transcribe ( $oDna, string $sSeq)

string $sSeq: Sequence of the nucleic acid as a string
$oDna

Inherited Methods

Inherited From Bio

Bio::__construct()
Bio::printWithNl()

Class Constants

Inherited Constants

Inherited from Bio

Bio::NEWLINE